*
Anybody out there know why concrete poured in the 20s or 30s was done in two steps? Usually the aggregate was 1 to 2 inches lower than the finish.
Discussion Forum
Discussion Forum
Up Next
Video Shorts
Featured Story
Skim-coating with joint compound covers texture, renews old drywall and plaster, and leaves smooth surfaces ready to paint.
Featured Video
Highlights
"I have learned so much thanks to the searchable articles on the FHB website. I can confidently say that I expect to be a life-long subscriber." - M.K.
Replies
*
Guess they don't make rocks like they used to. Back then, rocks were heavier than the cement mix, and sank to the bottom.
It's just like lumber - it's just not like it used to be.
*Concrete was mixed a lot of the time on site in much smaller batches. Toppings were sometimes used as a final leveller. A lot of floors were done with onsite cement mixers with a capacity of between 1 wheelbarrow to a full cubic yard or more.It's not uncommon, even today, to pour a topping on large pours when tolerances are demanding. (for example in many plants they use lifts that float on a cushion of air and require floors to have less than 1/8 inch variance.)Gabe
*Not to disagree with anyone here, but perhaps in years past, "old growth" stones were used... they were heavier and sort of sank into the mixture. Today we have to deal with stones which are genetically geared for fast growth, and they are lighter in weight.Not a concrete guy, Steve
*Be glad for what you have, they're talking about making stones out of recycled milk bottles soon.Trees from recycled coors cans.We'll be spending all our time pushing the aggregate back down into the cement, and can you imagine the number of blades yer going to go through on your wormdrive ?
*
Gabe,
Thanks for the reply, yours is the only one that made any sense. What are these ya-hoos thinking anyway, the rocks sank, yeah right. I was born at night but not last night.
*
Chris, it's not "ya-hoo", it's "YE-HA!".
Regards, Steve
*Chris - None of us actually think stones sink. I posted that for a couple of reasons. First, your post had slipped down the board quite a ways. Once it gets down towards the bottom, less people tend to notice it. And it worked, didn't it ? Second, I just wanted to poke a little fun. People are always talking about old growth lumber, and how much better it is than newer lumber. I thought the idea of "old growth rocks" was pretty funny. Please don't take us too seriously here.....................
*Yeah, and I missed Ron's earlier post and came up with the same "solution". It just shows how two great minds, working independently, can study a situation and generate an identical perceptive analysis of a complex matter.Not too seriously, Steve
*Old growth, new growth. You guys are full of it. That concrete was poured in the days of segregation. That aggregate wasn't about to hang out with the finish. And the finish was too(o) good for the aggregate. Nowadays, that kind of pour would be a violation of Federal Civil Rights laws. Where's Andrew, I'm sure he can explain it better.Rich Beckman
*Dang, Steve - I wonder what other creative solutions we could come up with for the world's problems if we put our heads together ?
*Ron, I unwisely diverted my time to anlayzing old growth stones, and a couple of other yahoos beat me in the race to map the human genome! I was at a disadvantage anyway, since they had some fancy computers and big staffs... I was using a magnifying glass, a Construction Master, a plumb bob and a speed square.Anyhow, I'm content to simply be the first to MEMEORIZE the genome. Here's a section I'm particularly fond of: gacttgcatgaaccctctgttacacgtctgaactgactccaatggacttcagagattcag(you may have other favorites, of course)Regards, Steve
*South of the equator the stones rise to the top. All slabs are aggregate there.hope this helps
*Steve - My most recent endeavor involves trying to help farmers, since I have a farming background. I was trying to research how much faster the ground dries out after daylight savings time kicks in every spring. (With the extra hour of sunlight every evening) So far my research is inconclusive.
*Actualy I think chris had it right the first time. At least in his title...Ever notice how the older you get, the closer certain parts get to the equator ?
*Ron, I'm happy to hear you're supporting our farming friends by dealing with the Daylight Savings Time issue. Frankly, I've been concerned for a long time regarding what is being done with the daylight that is saved. Is it in a daylight bank somewhere or what? Did anyone ever consider spreading the daylight around throughout the course of the year so we wouldn't have those "short" days in winter? Or maybe using the saved daylight for specific agricultural purposes such as you're addressing.I've heard that the days are shorter in Austrailia during our summer months, and longer down there during our winter period. It occurs to me it would be appropriate to initiate some sort of daylight exchange program which would work to everyone's advantage and at no cost (except shipping and handling) to either party.Perhaps we could also exchange stones, since we've learned here that Southern Hemisphere aggregate behaves in opposite fashion from that here. It's obvious, too, that equatorial stones must be evaluated, since they would seem to have neutral bouyancy.Keep up the good work, Steve
*Luka, that's it! Concrete is just a very thick liquid. Over many decades, the aggregate settles. All concrete ends up this way eventually.Rich Beckman
*
Chris, if the mix had a high water content, the rocks will sink. Also back then there were no transit mixers, it was done on-site and by hand, so the quality control was pretty erratic. Many times a slurry of cement and water was troweled over the still green concrete in order to get that smooth finish that is so desirable.
This is what I remember from my early childhood.I hope it answers your question. Gabe was right on the money with his answer as well.
Eddie Lomeli
*
Steve-
Would it possible to bank some daylight, and the have a night where it was light until morning, this could be a big help on some jobs that are behind schedule.
Going the next step, could I take a loan out on some daylight, paying back with intrest.
*> could I take a loan out on some daylight, paying back with intrest.Messi,You will have to demonstrate an ability to repay. What is your source of income of daylight? What are your daylight expenses? Remember, your expenses cannot exceed the maximum allowed percentage of income. Also, you need to show your daylight tax returns for the past three years. What? You haven't been paying your daylight taxes? Maybe it's best if you lay low.Rich Beckman
*Rich-While I cannot provide W2s to support my claimed daylight income, and can provide several credible references to atest to my ability to burn the candle at both ends.pete
*Here in Minn. we din't have a problem with daylight, it's the dark. In the winter there's just too much of it. We've taken to bailing it out of the house, but it hard to do because it seeps back in as fast as we can get it out. I think you guys have a much better idea. I've taken some empty pails out side, and tonight I'm going to fill them up during that extra hour of light. In January when we really feel the need, I'll open them up. Hey, a thought just occured,(too bad for you) they might make great gifts.Into the light? Steve
*I'd lay low, too, on that business about burning the candle at both ends... Although I can't cite any specific chapter or verse, I'll bet there's some sort of EPA regulation regarding candles. With both the EPA and IRS on your case, you may wish you thought of this: STEALING DAYLIGHT! Actually, you wouldn't really steal it, you'd just sort of gather up daylight that might have been wasted by others, or simply wasn't wanted. A few places you might acquire daylight:1. Owl roosts2. Lovers' Lanes3. Photo labsI'm sure others here can contribute to this list... All you'll need to gather the daylight is a few large mirrors, containers with tight-fitting lids, and, of course, Velcro.Good luck... Stevep.s. Here's another nice one I'd like to share with everyone: ggcatcgttacaggaatctcactgtaccgtggtataatcgccgtata
*Messi,I guess it's a good thing I'm not your banker. It sounds suspiciously like you plan on paying back the daylight with candlelight. That's like paying back a U.S. dollar loan with Canadian dollars.Rich Beckman
*Not sure how it is there, but here it seem there are many people who waste daylight.Thanks for the EPA tip on the candle burning. I'll look into a permit, or a waiver. Either way, sounds like an awful lot of paperwork...to bad that can't be done in the dark.I've found duct tape to be absolutely essential in collecting and storing daylight.
*Hey Is that new synthetic rock called "Trox" and has anybody used it? Skip
*
Anybody out there know why concrete poured in the 20s or 30s was done in two steps? Usually the aggregate was 1 to 2 inches lower than the finish.